CIE EXORDIO CERO MAYA LIBRO LIBRE HUATAPERA PROFESOR ESCRITOR
                          












 



 


     

 

 

 

 

 










.

índice

 

Tipificación metabólica y genéticomolecular de Escherichia coli diarreagénica

Nohemí Carreras Villaseñor, Jesús Andrei Rosales Castillo, Gerardo Vázquez Marrufo,

Ma. Soledad Vázquez Garcidueñas

 

A nivel nacional las enfermedades infecciosas intestinales ocupan el cuarto lugar como causas de fallecimiento infantil. En la ciudad de Morelia, Michoacán el principal agente causal son cepas patógenas de Escherichia coli. de las cuales a la fecha se desconoce el patotipo específico al cual pertenecen. Entre las técnicas para la tipificación de bacterias están las pruebas microbiológicas, bioquímicas y serológicas, actualmente las técnicas de biología molecular como la PCR son complementarias a los métodos existentes y tienen ventajas en términos de rapidez, sensibilidad e información genética generada. En este trabajo se analizaron 18 aislados de E. coli provenientes del mismo número de pacientes menores de 5 años con diarrea aguda provenientes de Morelia, Michoacán. La identificación metabólica con el sistema BIOLOG indicó que el 72% de los aislados fueron Escherichia coli, 17% Morganella morganii ss morganii y el 11% Salmonella gp1 (choleraesuis) ST paratyphi A. Sin embargo por amplificación del gen 16S de rDNA de E. coli todos los aislados resultaron ser E. coli. El grupo patógeno de cada uno de los aislados determinados por PCR dúplex dio como resultado que el 100% de estos aislados fueron del tipo E. coli enterotoxigénica LT y el 0.05% es además del grupo ST.

Introducción

Las enfermedades diarreicas constituyen una de las principales causas de morbilidad en los paises en desarrollo y son la causa de 12600 muertes diarias en niños menores de 5 años en Latinoamérica, Asia y África. Los agentes etiológicos de la diarrea incluyen un gran número de virus, bacterias y parásitos (Guerrant y col. 1990). Entre las bacterias que pueden ocasionar diarrea (Brooks, 1999), Escherichia coli juega un papel importante, ya que es el anaerobio facultativo predominante de la microflora intestinal humana y algunas de sus cepas han desarrollado la capacidad de causar enfermedades en el tracto gastrointestinal (Nataro y Kaper, 1998). Las cepas diarreagénicas de E. coli se clasifican por su serotipo y propiedades de virulencia en enteropatogénicas (EPEC), enterotoxigénicas (ETEC), enteroinvasivas (EIEC), verotoxigénicas (VTEC) o enterohemorrágicas (EHEC), enteroagregativas (EAEC) y con adherencia difusa (ADEC) (Levine, 1997). Cada grupo causa la enfermedad por un mecanismo diferente por lo que producen infeciones y síndromes distintos. Existen numerosas técnicas para la identificación, tipificación y/o monitoreo de bacterias y según el problema es preferible la utilización de un método respecto a otro (Nataro y col., 1998). Para la detección de E. coli diarreagénica, existen reacciones bioquímicas, la serotipificación, los ensayos fenotípicos basados en características de virulencia y algunos métodos moleculares entre los que se incluyen los basados en la PCR (Reacción en cadena de la polimerasa por sus siglas en inglés) que tiene alta sensibilidad y especificidad y da resultados rápidos (Bellin, y col., 2001; Stacy-Phipps y col., 1995).

La sustitución irresponsable de los procedimientos rigurosos de laboratorio clínico y los métodos microbiológicos clásicos del diagnóstico de enfermedades infecciosas con la técnica de PCR puede dar como resultado la pérdida de información clínica crítica y de colecciones vitales de aislados de patógenos. Las técnicas de PCR no pueden reemplazar a otros métodos pero pueden llenar vacíos y contestar las preguntas que no pueden ser resueltas por otros métodos (Tornieporth y col. 1995). Los resultados del monitoreo de bacterias enteropatógenas como es el caso de E. coli, pueden ser más confiables si se utiliza una combinación de las técnicas tradicionales con los métodos moleculares, mejor llamada aproximación polifásica (Vandamme y col., 1996).

Con la finalidad de detectar de manera precisa las categorías de E. coli presentes en las heces diarreicas de una muestra de niños menores de 5 años de la Ciudad de Morelia, Michoacán, en este trabajo se aislaron las bacterias presentes en dichas muestras y se tipificaron utilizando miroarreglos metabólicos (Microestación BIOLOG) y PCR dúplex combinando los iniciadores específicos para EIEC, EPEC y ETEC.

Metodología

Material biológico. Se utilizaron como control las cepas  bacterianas de referencia (EPEC, ETEC y EIEC) que fueron adquiridas en el Instituto de Diagnóstico y Referencia Epidemiológica (InDRE) y 18 aislados de Escherichia coli diarreagénica provenientes de las heces de pacientes, infantes menores de 5 años de la Ciudad de Morelia, Michoacán, México. 

Identificación con el sistema BIOLOG. Con cada uno de los aislados clínicos precrecidos en agar BUGTM (Biolog, Inc.), se preparó una suspensión a una densidad del 20% T (± 2%) en el fluido de inoculación GN/GP, con esta suspensión se inocularon microplacas Biolog GN2, se incubaron a 37ºC y se realizaron lecturas a las 4, 6, 16 y 24 h de incubación.

Extracción de ADN bacteriano. Las colonias bacterianas crecidas en medio Luria Bertani sólido se cosecharon y colocaron en 400 μL de regulador de lisis (Tris-HCl 100 mM pH 8.0, SDS 2%, NaCl 100 mM, EDTA 50 mM) y se procedió con la extracción según el método reportado por Vázquez-Marrufo y col. (2002). La integridad del ADN obtenido se visualizó desarrollando una electroforesis en gel de agarosa al 1% teñido con bromuro de etidio (Sambrook y col., 1989).

Reacciones de amplificación. Se utilizaron los siguientes pares de iniciadores: para la amplificación del gen 16 de RNAr, ECA 75F (GGAAGAAGCTTGCTTCTTTGCTGAC) y ECR 619R (AGCCCGGGGATTTCACATCTGACTTA); para la toxina LT de ETEC, LT1 (GCGACAAATTATACCGTGCT) y LT-2 (CCGAATTCTGTTATATATGT); para la toxina ST de ETEC, ST-1 (CTGTATTTGTCTTTTTCACCT) y ST-2 (GCACCCGGTACAAGCAGGAT); para el gen ipaH de EIEC, EI- 1 (GCTGGAAAAACTCAGTGCCT) y EI-2 (CCAGTCCGTAAATTCATTCT) y para el gen BFP de EPEC,EP-1 (CAATGGTGCTTGCGCTTGCT) y EP-2 (GCCGCTTTATCCAACCTGGT). La composición de la mezcla de PCR fue: Tris-HCl pH 9.0 10 mM, MgCl2 1.0 mM, 0.2 mM de cada deoxinucleosido trifosfato, 1 mM de cada iniciador, 0.5 U de Taq polimerasa y 25 ng de ADN en un volumen total de 25 mL. La amplificación se realizó en un termociclador GeneAmp® PCR System 2700 de Applied Biosystems bajo las siguientes condiciones, desnaturalización a 94°C por 5 minutos, seguido por 35 ciclos de 45 segundos a 94°C, 1 minuto a 50°C y 1 minuto a 72°C con una extensión final a 72°C por 7 minutos. Los productos de amplificación obtenidos se visualizaron en un gel de agarosa al 1 %.

Resultados

El análisis con el Sistema BIOLOG dio como resultado que el 72% de los aislados fueron Escherichia coli, 17% Morganella morganii ss morganii y el 11% Salmonella gp1 (choleraesuis) ST paratyphi A.Con la finalidad de determinar molecularmente la especie de los aislados clínicos tipificados metabólicamente, se realizaron ensayos de amplificación mediante PCR utilizando el ADN de cada uno de los aislados y los iniciadores específicos para el gen 16S de RNAr de E. coli, obteniéndose para todas las muestras una sola banda de aproximadamente 544 pb que era el tamaño esperado (Fig. 1)

 

A continuación se realizó la amplificación por PCR de las cepas de referencia con los iniciadores específicos para cada uno de los patotipos. En el caso de la cepa de referencia ETEC-LT, se obtuvo una sola banda de 708 pb, mientras que para la cepa de referencia del grupo EIEC se obtuvo una banda de 424 pb (Fig. 2A, carriles 1 y 2). Para la cepa del grupo EPEC el producto de amplificación obtenido fue de 324 pb y para el caso de la cepa de referencia del grupo ETEC-ST el tamaño de la banda generada fue de 182 pb (Fig. 2A, carriles 3 y 4). Para las muestras problema, 17 aislados dieron un patrón de amplificación positivo para el gen ST (Fig. 2B) con un tamaño aproximado de 182 pb y otra muestra que dio además una banda de amplificación de aproximadamente 708 pb, de acuerdo a lo esperado para la región LT (Fig. 2B carril 2).

Conclusiones

Los resultados de utilización de fuentes de carbono mediante el uso de placas BIOLOG, obtenidos con los aislados clínicos, indicaron que aunque molecularmente estos aislados fueron tipificados como E. coli, metabólicamente solo el 72 % se comportaron como especies de este género y el 17 % como Morganella la cual también es una enterobacteria pero que se presenta comúnmente solo en infecciones intrahospitalarias, esto solo refleja las características funcionales del organismo capaz de crecer en las placas bajo las condiciones utilizadas (Smalla y col., 1998). y solo la secuenciación del gen 16S de RNAr nos permitirá saber si fueron las condiciones en que se llevaron acabo los ensayos los que hicieron que estas cepas se comportaran como Morganella o si en realidad son E. coli. Los resultados de amplificación por PCR mostraron que el grupo patógeno predominante en las muestras problema fue ETEC. Dicho resultado concuerda con lo descrito por Cravioto y colaboradores (1985) que reportan en el estado de Morelos, entre 1982 y 1985, a cepas del grupo ETEC como el principal agente productor de diarrea (33.5%). Además Guerrant y col. (1999) encontraron que las cepas del grupo ETEC son endémicas de nuestro medio, las cuales causan diarrea del turista en todo el mundo. En un estudio realizado recientemente en el Valle de Chalco del Edo. de México, se encontró que en un 62% de los casos de infección se encontraron cepas del grupo ETEC, de las que el 44.6% se identificaron como productoras de la toxina LT, 11.2% como productoras de la toxina ST y 44.1% productora de ambas toxinas (Cortés-Ortiz y col., 2002). La razón de que ETEC sea el grupo bacteriano que se encuentra más frecuentemente relacionado con brotes y problemas gastrointestinales posiblemente se deba a que es más resistente al medio ambiente y por lo tanto se encuentre en mayor proporción, o que su capacidad de colonización sea más efectiva.

 

Referencias

 

Bellin, T., M. Pulz, A. Matussek, H. G. Hempen, and F. Gunzer. 2001. Rapid detection of enterohemorrhagic Escherichia coli by real-time PCR with fluorescent hybridization probes. J. Clin. Microbiol. 39:370-374.

Brooks,G.F., Bute, J.S., Morse, S.A.1999. Microbiología Médica de Jawetz, Melnick y Adelberg. 16ª. Ed. Manual Moderno Cortés-Ortiz, I.A., Rodríguez-Ángeles, G., Moreno-Escobar, E.A., Tenorio-Lara, J.M., Torres- Mazadiego, B.P., Montiel-Vázquez, E. 2002. Brote causado por Escherichia coli en Chalco, México. Salud Pública de México. 44:297-302.

Cravioto, A., Ortega, R., Rodríguez, P., Reyes, R., López, D., Fernández, G. 1985. Estudio longitudinal de colonización intestinal en ua cohorte de niños rurales mexicanos. Diseño del estudio y hallazgos iniciales durante el periodo neonatal. Bol. Med. Hosp. Infant. Mex. 42:287-296

Guerrant, R. L., J. M. Hughes, N. L. Lima, and J. Crane. 1990. Diarrhea in developed and developing countries: magnitude, special settings, and etiologies. Rev. Infect. Dis. 12 (Suppl. 1):S41-S50. Levine, M. M. 1987.

Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 155:377-389.

Nataro, J. P., T. Steiner, and R. L. Guerrant. 1998. Enteroaggregative Escherichia coli. Emerg. Infect. Dis. 4:251-261.

Nataro, J. P. and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201.

Sambrook, J, Maniatis, T., and Frisch, E. F. 1989. Molecular cloning: a laboratory manual. New York, Cold Spring Harbor, USA

Smalla K., U. Wachtendorf, H. Heuer, W. T. Liu, and L Forney. 1998. Analysis of BIOLOG GN substrate utilization patterns by microbial communities. Appl. Environ. Microbial. 64:1220-1225.

Stacy-Phipps, S., J. J. Mecca, and J. B. Weiss. 1995. Multiplex PCR assay and simple preparation method for stool specimens detect enterotoxigenic Escherichia coli DNA during course of infection. J. Clin. Microbiol. 33:1054-1059.

Tornieporth, N.G., Jonh, J., Salgado, K., De Jesus, P., Latham, E., N. Melo, M.C., Gunzburg, S.T., Riley, L.W. 1995. Differentation of Pathogenic Escherichia coli strains in Brazilian Children by PCR. Journal or Clinical Microbiology. 33:1371-1374

Vandamme P., Pot B., Gillis M., De Vos P., Kersters K. And Swings J. 1996. Polyphasic Taxonomy, a Consensus Approach to Bacterial Systematics. Microbiological Reviews. 60 2:407-438.

Vázquez-Marrufo, G., Vázquez-Garcidueñas, S., Gómez- Luna, B. E. and Olalde-Portugal, V. 2002. DNA isolation from forest soil suitable for PCR assays of fungal and plant rRNA genes. Plant Molecular Biology Reporter. 20: 379-390.

Hit Counter

índice